BAS-010 Braindumps

Great Sources for Pass4sure BAS-010 exam PDF | cheat sheets | stargeo.it

Killexams.com BAS-010 Exam simulator is only required for BAS-010 prep - it is made of BAS-010 exam prep - braindumps - examcollection and VCE - cheat sheets - stargeo.it

Pass4sure BAS-010 dumps | Killexams.com BAS-010 actual questions | http://www.stargeo.it/new/


Killexams.com BAS-010 Dumps and actual Questions

100% actual Questions - Exam Pass Guarantee with tall Marks - Just Memorize the Answers



BAS-010 exam Dumps Source : IBM SPSS Modeler Professional v2

Test Code : BAS-010
Test name : IBM SPSS Modeler Professional v2
Vendor name : IBM
: 55 actual Questions

in which can i locate celebrate guide for pleasant information simultaneous BAS-010 examination?
That is genuinely the fulfillment of killexams.com, not mine. Very person pleasant BAS-010 exam simulator and actual BAS-010 QAs.


So cleanly questions in BAS-010 exam! i was already enough organized.
There is one topic Differentiate BAS-010 exam which is very steely and tough for me but killexams.com succor me in elapsing me that. It was astonishing to notice that greater piece questions of the cogent exams were regular from the aide. I was searching for some exam result. I connected the from killexams.com to rep my-self ready for the exam BAS-010. A score of 85% noting 58 questions inside 90 minutes was composed well. Much thanks to you.


can i find actual of BAS-010 examination?
Some Great news is that I passed BAS-010 test yesterday... I thank Entire killexams.com Team. I really appreciate the Great toil that you utter do... Your training material is excellent. retain doing pleasant work. I will definitely consume your product for my next exam. Regards, Emma from original York


Right space to find BAS-010 Latest dumps paper.
I was a lot dissatisfied in the ones days due to the fact I didnt any time to achieve together for BAS-010 exam prep because of my some daily ordinary toil I hold to disburse maximum time on the way, a long distance from my domestic to my toil region. I become a lot involved approximately BAS-010 exam, due to the fact time is so close to, then at some point my friend advised about killexams.com, that become the gyrate to my existence, the reply of my utter troubles. I could conclude my BAS-010 exam prep on the manner effortlessly by means of using my laptop and killexams.com is so dependable and fantastic.


It became extremely pleasant to hold actual exam questions today's BAS-010 examination.
I wanted to hold certification in Test BAS-010 and i am getting it with killexams. flawless pattern of latest modules facilitate me to strive utter the 38 questions in the given timeframe. I marks more than 87. I should whine that I could in no artery ever hold done it on my own what I became capable of obtain with killexams.com . killexams.com provide the cutting-edge module of questions and cowl the related topics. Thanks to killexams.com .


proper source to rep BAS-010 modern brain sell off paper.
I was trapped in the complicated topics most effective 12 earlier days the exam BAS-010. Whats greater it becomeextremely beneficial, as the quick solutions can subsist resultseasily remembered internal 10 days. I scored ninety one%, endeavoring utter questions in due time. To retain my planning, i used to subsist energetically looking down some rapid reference. It aided me a wonderful deal. Never thought it can subsist so compelling! At that point, by using one technique or a few other I came to recall killexams.com Dumps.


Its pleasant to read books for BAS-010 exam, but ensure your success with these .
by no means suspected that the issues that I had dependably fled from would subsist any such splendid amount of enjoyableto examine; its light and brief approach for buying to the focuses made my planning component less worrying and helpme in getting 89% marks. utter because of killexams.com dumps, I never concept i would pass my exam yet I did enddecisively. i was going to give up exam BAS-010 when you deem that I wasnt nice approximately whether i would pass or not. With truely every week staying I selected to switch to Dumps for my exam making plans.


the artery to prepare for BAS-010 examination in shortest time?
passed BAS-010 exam a few days in the past and got an pattern score. however, I cannot bewitch complete credit scorefor this as I used killexams.com to prepare for the BAS-010 exam. two weeks after kicking off my practice with their exam simulator, I felt like I knew the solution to any question that might arrive my manner. and i actually did. every question I examine at the BAS-010 exam, I had already seen it at the same time as practising. If now not each, then tremendous majority of them. the gross thing that turned into in the practise percent turned out to subsist very pertinent and beneficial, so I cant thank enough to killexams.com for making it manifest for me.


It became extremely pleasant to hold actual exam questions today's BAS-010 examination.
i am very happy birthright now. You must subsist wondering why i am so satisfied, rightly the purpose is pretty easy, I just got my BAS-010 test consequences and i hold made it via them pretty without difficulty. I write over birthright here because it was this killexams.com that taught me for BAS-010 check and i cant pass on with out thanking it for being so beneficiant and helpful to me at some point of.


determined most BAS-010 Questions in actual test questions that I organized.
I passed this exam with killexams.com and hold recently obtained my BAS-010 certificate. I did utter my certifications with killexams.com, so I cant compare what its like to bewitch an exam with/without it. Yet, the fact that I retain coming back for their bundles shows that Im delighted with this exam solution. I treasure being able to practice on my computer, in the comfort of my home, especially when the vast majority of the questions appearing on the exam are exactly the same what you saw in your exam simulator at home. Thanks to killexams.com, I got up to the Professional level. I am not sure whether Ill subsist piteous up any time soon, as I appear to subsist delighted where I am. Thanks Killexams.


IBM IBM SPSS Modeler Professional

Predictive Analytics application market's visionary leaders illuminated by original report | killexams.com actual Questions and Pass4sure dumps

IBM tops the listing of vendors within the predictive analytics application house in response to a quadrant currently released via 360Quadrants, adopted closely with the aid of Oracle and SAP SE. IBM’s SPSS Modeler changed into rated the most suitable in product nice, reliability, and breadth and depth of offering. IBM SPSS Modeler additionally captured the excellent spot in standards like geographic footprint and viability of company.

360Quadrants defines predictive analytics as a statistical and information mining solution such as numerous algorithms and methodologies used for structured in addition to unstructured facts to extract company insights. 

360Quadrants covers 50+ items within the predictive analytics area and locations the birthright 31 of them in a quadrant reckoning on their exceptional, reliability, and company result. These 31 products are classified into Visionary Leaders, Dynamic Differentiators, rising businesses, and Innovators.

360Quadrants acknowledges IBM Corp, SAS Institute, Inc., SAP SE, reasonable Issac corporation (FICO), Tableau utility, Inc., RapidMiner, Inc., Oracle Corp, and Angoss utility Corp as Visionary Leaders; TIBCO software, Inc., Microstrategy, Inc., Alteryx, Inc., suggestions Builder, Dataiku, KNIME.COM AG, and NTT facts service provider, as Innovators; GoodData organization, Microsoft employer, Teradata organisation, Sisense, Inc., Predixion utility, and Domino information Lab, Inc. as Dynamic Differentiators; and Exago, integrated, AgilOne, QlikTech overseas, and Kognitio Ltd. as rising avid gamers.

This e-mail address is being included from spambots. You need JavaScript enabled to view it.


a glance on the IBM SPSS Modeler and IBM SPSS facts analytics paraphernalia | killexams.com actual Questions and Pass4sure dumps

IBM's SPSS predictive analytics paraphernalia consist of IBM SPSS Modeler and IBM SPSS records. SPSS Modeler provides information mining and textual content analysis software, whereas SPSS facts is an built-in family of items. each tools enable clients to build predictive models and execute different analytics projects.

The IBM SPSS Modeler ambitions clients who hold slight or no programming competencies. clients are provided with a drag-and-drop user interface, enabling them to construct predictive fashions and duty different facts analytics. Modeler can apply diverse methods and algorithms to befriend the person find tips hidden within the facts. The device can moreover befriend in integrating and consolidating utter types of records units from dispersed statistics sources across the company.

The IBM SPSS facts suite is an built-in set of products geared toward extra professional facts analysts. SPSS statistics addresses the comprehensive analytical procedure, from planning to facts assortment, evaluation, reporting and deployment.

IBM SPSS Modeler points

version 18 gives the following points:

  • greater than 30 ground laptop discovering algorithms.
  • Extensions that provide continued improvements for consume with open supply products, similar to R and Python.
  • better befriend for a few multithreaded analytical algorithms, together with Random bushes, Tree-AS, Generalized Linear Engine, Linear-AS, Linear assist Vector computer and Two-Step-AS clustering.
  • The skill to race a number of Python and Spark computing device getting to know, as well as different Python analytics libraries natively in Modeler without requiring the consume of the Analytic Server, as became required in the antiquated version.
  • SPSS Modeler bundles are deployed on premises, and SPSS Modeler Gold is purchasable as a cloud providing. The customer entrance End of SPSS Modeler runs under windows and macOS, while the server constituent runs on Unix, Linux and windows.

    IBM SPSS Modeler gives here editions:

  • SPSS Modeler personal: A single-user desktop product.
  • SPSS Modeler expert: A computing device product that works with IBM SPSS Analytic Server, presenting greater scalability and efficiency and enabling functions to subsist used across a company.
  • SPSS Modeler top class: This version contains superior algorithms and capabilities, reminiscent of text analytics, entity analytics and sociable network evaluation, that enlarge model accuracy with unstructured facts.
  • SPSS Modeler Gold: This edition gives analytical decision administration, collaboration and deployment capabilities. SPSS Modeler Gold is moreover accessible as a cloud providing.
  • IBM SPSS statistics elements

    SPSS records version 24 contains the following original features:

  • The means to entry more than a hundred extensions, enabling users to bewitch advantage of free libraries written in R, Python and SPSS syntax.
  • The IBM SPSS Extension Hub to browse, down load, update, rep rid of and usually exploit extensions.
  • a massive upgrade to the custom Dialog Builder, enabling users to greater readily build and installation their personal extensions. Enhancements include original controls and original residences for existing controls and a brace of other advancements to the user interface.
  • improvements that allow users to greater simply and immediately import and export records into SPPS records.
  • improvements to the custom Tables module, together with original statistical performance and customer-requested elements.
  • IBM SPSS facts presents the following three versions (each and every with extra modules):

  • SPSS facts medium tools supply superior statistical approaches that befriend linear and nonlinear statistical models, in addition to predictive simulation modeling, which bills for uncertain inputs, geospatial analytics and customised tables.
  • SPSS statistics professional tools uphold facts preparation, lacking values and records validity, decision timber, and forecasting.
  • SPSS statistics top rate provides superior analytical options, including structural equation modeling, in-depth sampling assessment and checking out. This bundle moreover includes strategies that goal direct advertising and marketing and excessive-conclusion charts and graphs.
  • Pricing for the SPSS Modeler and SPSS facts predictive analytics tools fluctuate depending on the bundle alternatives, the variety of clients and the license duration. SPSS statistics is now obtainable as a subscription alternative or a perpetual license. IBM offers free trials of both IBM SPSS Modeler and IBM SPSS facts.

    next Steps

    Why the term unstructured information is a misnomer

    How massive facts is changing statistics modeling recommendations

    huge information techniques pose original challenges to facts governance

    connected substances View greater

    IBM Watson Studio is Coming to Your desktop | killexams.com actual Questions and Pass4sure dumps

    example of a Modeler circulation working on Watson Studio desktop

    IBM Watson Studio is an extremely potent facts science providing. in case you’re now not universal, Watson Studio is an built-in atmosphere designed to consequence it effortless to develop, coach, and manage models. It comprises a large choice of tools used for everything from records prep and coalesce to photo focus. And now Watson Studio is on its option to your windows or Mac computer computer.

    Overview of Watson Studio

    Watson Studio contains numerous paraphernalia utter within one integrated atmosphere. the most well-liked paraphernalia of Watson Studio are:

  • SPSS Modeler for facts prep, blend, and modeling without coding
  • information Refinery, a spreadsheet vogue device, that allows for quickly, self-provider facts preparation
  • Python, R, and Scala Jupyter Notebooks to create and participate documents that comprise are live code, equations, visualizations, and explanatory textual content
  • Neural network Modeler for designing TensorFlow, Keras, PyTorch and Caffe buildings without coding
  • Interactive Dashboards to bring sharable live stories so the conclusion clients can ascertain their personal insights
  • attainable Deployment alternate options

    Watson Studio will quickly subsist accessible as three deployment alternate options:

  • Watson Studio on the IBM Cloud is the simplest artery to rep began. It presents 3 tiers from a free starter tier with pay-as-you-go compute the entire approach to an enterprise version.
  • Watson Studio local is their at the back of-the-firewall solution proposing a cozy approach so as to add Watson Studio capabilities to your commercial enterprise. comprises purchase alternatives for a handful of users or the total company.
  • And coming quickly: Watson Studio laptop
  • Introducing Watson Studio computer

    Watson Studio desktop is their original third deployment alternative inside the Watson Studio family. It takes probably the most generic parts of what's obtainable within Watson Studio on the cloud and ports it to your windows or Mac computer for offline use, for analysis of information data you don’t need to upload, and for snappy performance. utter with a lickety-split and light computing device setting up.

    Watson Studio on the computing device will scale from an individual user utter the mode up to a large team, and may subsist an outstanding addition to the Watson Studio family unit along with their cloud and autochthonous flavors.

    The introductory main facets of Watson Studio computing device could subsist a SPSS Modeler canvas along side the facts refinery spreadsheet editor. this can encompass backwards compatibility for SPSS Modeler streams.

    advantages of Watson Studio computer
  • It’s quick, specifically for local files. boost individual productiveness using a locally installed customer.
  • It offers offline use. are looking to construct a mannequin on a aircraft with out WiFi? Watson Studio desktop will toil devoid of an internet connection for weeks at a time.
  • Adhere to security and governance mandates with your records. Watson Studio laptop allows for your gross records to tarry for your machine.
  • unlimited modeling without overages. the usage of Watson Studio computing device, you can develop fashions without any incremental can charge. This means that you can build models iteratively on your laptop, then stream it to Watson Studio on the Cloud to installation.
  • It’s one Watson Studio, so no re-discovering required. With the same designs because the cloud and autochthonous types, switching between deployment alternate options is seamless with out a enjoyable practising.
  • And identical to the leisure of Watson Studio, any person — coders or non-coders — may subsist capable of prepare, mix, explore, and mannequin their records in barely minutes.
  • Watson Studio computer’s powerful graphing competenciesJoin the Beta

    The Beta for Watson Studio is beginning now with two paraphernalia already ported to the desktop: a refreshed version of SPSS Modeler & facts Refinery. it will additionally include tasks to organize your work, records belongings organization, and a light determine for updates feature.

    be piece of the beta to provide remarks on how you like these tools, and suggest which different tools they bring to the laptop. The Beta is a piece of the IBM SPSS Modeler Subscription Trial, so once you register for that you simply’ll hold access to each downloads.

    After you register, peep for the “IBM SPSS Modeler Subscription Trial” card, click on download, then you definately’ll notice the Watson Studio laptop Beta downloads on the birthright hand side of the web page.

    be piece of the dialogue on the beta community

    After registering for the beta, unite in the discussion on the Watson Studio desktop beta neighborhood. birthright here that you would subsist able to inquire of questions in regards to the beta, supply techniques for future aspects, rep forum support, and bewitch piece in valuable surveys to impress product course. subsist a piece of the forum here by logging in along with your IBMid.

    wait for future announcements here about this entertaining addition for the Watson Studio household.

    Watson Studio computing device venture organizer

    While it is very hard task to elect dependable certification questions / answers resources with respect to review, reputation and validity because people rep ripoff due to choosing wrong service. Killexams.com consequence it sure to serve its clients best to its resources with respect to exam dumps update and validity. Most of other's ripoff report complaint clients arrive to us for the brain dumps and pass their exams happily and easily. They never compromise on their review, reputation and attribute because killexams review, killexams reputation and killexams client confidence is necessary to us. Specially they bewitch care of killexams.com review, killexams.com reputation, killexams.com ripoff report complaint, killexams.com trust, killexams.com validity, killexams.com report and killexams.com scam. If you notice any False report posted by their competitors with the name killexams ripoff report complaint internet, killexams.com ripoff report, killexams.com scam, killexams.com complaint or something like this, just retain in intelligence that there are always dismal people damaging reputation of pleasant services due to their benefits. There are thousands of satisfied customers that pass their exams using killexams.com brain dumps, killexams PDF questions, killexams practice questions, killexams exam simulator. Visit Killexams.com, their sample questions and sample brain dumps, their exam simulator and you will definitely know that killexams.com is the best brain dumps site.

    Back to Braindumps Menu


    920-450 VCE | EADP10 actual questions | 1Y0-402 questions and answers | A00-280 questions and answers | 000-221 sample test | FM0-302 test prep | 000-582 braindumps | NS0-310 mock exam | 050-701 study guide | 70-705 cram | P2065-749 dumps | 1Z0-225 brain dumps | IBMSPSSMBPDM pdf download | C4040-224 braindumps | HP0-782 braindumps | NCEES-PE practice test | 920-324 practice test | P2090-068 dumps questions | CPFO free pdf | 000-070 brain dumps |


    Memorize these BAS-010 dumps and register for the test
    killexams.com provide latest and updated practice Test with Actual test Questions and Answers for original syllabus of IBM BAS-010 Exam. practice their actual Questions and braindumps to help your learning and pass your exam with tall Marks. They ensure your success in the Test Center, covering utter the topics of exam and build your learning of the BAS-010 exam. Pass 4 sure with their accurate questions. Huge Discount Coupons and Promo Codes are provided at http://killexams.com/cart

    Are you searching for IBM BAS-010 Dumps containing actual exam Questions and Answers for the IBM SPSS Modeler Professional v2 test prep? they proffer most updated and attribute supply of BAS-010 Dumps that's http://killexams.com/pass4sure/exam-detail/BAS-010. they hold got compiled an information of BAS-010 Dumps questions from actual tests so as to allow you to prepare and pass BAS-010 exam on the first attempt. killexams.com Discount Coupons and Promo Codes are as under; WC2017 : 60% Discount Coupon for utter exams on website PROF17 : 10% Discount Coupon for Orders larger than $69 DEAL17 : 15% Discount Coupon for Orders larger than $99 SEPSPECIAL : 10% Special Discount Coupon for utter Orders You ought to rep the recently updated IBM BAS-010 Braindumps with the correct answers, that are ready via killexams.com specialists, helping the candidates to understand and relish regarding their BAS-010 exam path, you will not realize BAS-010 exam of such attribute within the marketplace. Their IBM BAS-010 brain Dumps are given to candidates at acting 100% of their test. Their IBM BAS-010 exam dumps are working Great within the test centers, providing you with an break to space along in your BAS-010 exam.

    On the off peril which you are searching for BAS-010 practice Test containing actual Test Questions, you're at remedy area. They hold amassed database of questions from Actual Exams with a particular ultimate objective to empower you to devise and pass your exam at the essential endeavor. utter instructing materials at the site are Up To Date and certified by methods for their specialists.

    killexams.com supply most updated and updated practice Test with Actual Exam Questions and Answers for original syllabus of IBM BAS-010 Exam. practice their actual Questions and Answers to help your observation and pass your exam with tall Marks. They guarantee your prosperity inside the Test Center, overlaying every terminal one of the purposes of exam and build your learning of the BAS-010 exam. Pass with their novel questions.

    Our BAS-010 Exam PDF incorporates Complete Pool of Questions and Answers and Brain dumps verified and demonstrated which incorporate references and clarifications (inpertinent). Their goal to amass the Questions and Answers isn't just to pass the exam before everything attempt anyway Really help Your learning around the BAS-010 exam focuses.

    BAS-010 exam Questions and Answers are Printable in tall attribute Study guide that you may down load in your Computer or a brace of other gadget and initiate setting up your BAS-010 exam. Print Complete BAS-010 Study Guide, convey with you when you are at Vacations or Traveling and devour your Exam Prep. You can rep to updated BAS-010 Exam from your on line report at whatever point.

    killexams.com Huge Discount Coupons and Promo Codes are as under;
    WC2017: 60% Discount Coupon for utter exams on website
    PROF17: 10% Discount Coupon for Orders greater than $69
    DEAL17: 15% Discount Coupon for Orders greater than $99
    DECSPECIAL: 10% Special Discount Coupon for utter Orders


    Download your IBM SPSS Modeler Professional v2 Study guide instantly alongside acquiring and Start Preparing Your Exam Prep birthright Now!

    BAS-010 Practice Test | BAS-010 examcollection | BAS-010 VCE | BAS-010 study guide | BAS-010 practice exam | BAS-010 cram


    Killexams HP2-E42 actual questions | Killexams CBM test prep | Killexams 1Z0-527 questions and answers | Killexams 3107 cram | Killexams HP0-281 braindumps | Killexams C9560-503 braindumps | Killexams 920-177 braindumps | Killexams 642-415 test prep | Killexams P2020-300 free pdf | Killexams CPA-REG mock exam | Killexams PCCE free pdf download | Killexams HP0-790 practice exam | Killexams 300-375 practice test | Killexams C2040-929 VCE | Killexams A2090-558 practice questions | Killexams 642-889 practice questions | Killexams 190-846 sample test | Killexams IC3-2 actual questions | Killexams HP2-Z28 braindumps | Killexams ECP-102 test prep |


    killexams.com huge List of Exam Braindumps

    View Complete list of Killexams.com Brain dumps


    Killexams HP0-651 practice test | Killexams HP0-655 cheat sheets | Killexams CSSGB questions and answers | Killexams 000-780 pdf download | Killexams MB6-897 test questions | Killexams 1Z0-543 dump | Killexams C2150-596 exam prep | Killexams ST0-47X exam prep | Killexams 000-565 mock exam | Killexams HP0-656 study guide | Killexams ECDL-ADVANCED test prep | Killexams 70-498 questions and answers | Killexams HP3-X04 questions answers | Killexams C2140-138 test prep | Killexams 00M-237 VCE | Killexams 2V0-751 examcollection | Killexams 000-341 sample test | Killexams 70-561-VB free pdf | Killexams JN0-340 braindumps | Killexams 7004-1 practice questions |


    IBM SPSS Modeler Professional v2

    Pass 4 sure BAS-010 dumps | Killexams.com BAS-010 actual questions | http://www.stargeo.it/new/

    A peep at the IBM SPSS Modeler and IBM SPSS Statistics analytics tools | killexams.com actual questions and Pass4sure dumps

    IBM's SPSS predictive analytics tools consist of IBM SPSS Modeler and IBM SPSS Statistics. SPSS Modeler provides data mining and text analysis software, while SPSS Statistics is an integrated family of products. Both tools enable users to build predictive models and execute other analytics tasks.

    The IBM SPSS Modeler targets users who hold slight or no programming skills. Users are provided with a drag-and-drop user interface, enabling them to build predictive models and perform other data analytics. Modeler can apply different processes and algorithms to befriend the user ascertain information hidden in the data. The instrument can moreover assist in integrating and consolidating utter types of data sets from dispersed data sources across the organization.

    The IBM SPSS Statistics suite is an integrated set of products geared toward more professional data analysts. SPSS Statistics addresses the complete analytical process, from planning to data collection, analysis, reporting and deployment.

    IBM SPSS Modeler features

    Version 18 provides the following features:

  • More than 30 ground machine learning algorithms.
  • Extensions that provide continued improvements for consume with open source products, such as R and Python.
  • Enhanced uphold for several multithreaded analytical algorithms, including Random Trees, Tree-AS, Generalized Linear Engine, Linear-AS, Linear uphold Vector Machine and Two-Step-AS clustering.
  • The aptitude to race a variety of Python and Spark machine learning, as well as other Python analytics libraries natively in Modeler without requiring the consume of the Analytic Server, as was required in the previous version.
  • SPSS Modeler bundles are deployed on premises, and SPSS Modeler Gold is available as a cloud offering. The client front End of SPSS Modeler runs under Windows and macOS, while the server component runs on Unix, Linux and Windows.

    IBM SPSS Modeler provides the following editions:

  • SPSS Modeler Personal: A single-user desktop product.
  • SPSS Modeler Professional: A desktop product that works with IBM SPSS Analytic Server, providing improved scalability and performance and enabling applications to subsist used across an organization.
  • SPSS Modeler Premium: This edition includes advanced algorithms and capabilities, such as text analytics, entity analytics and sociable network analysis, that enlarge model accuracy with unstructured data.
  • SPSS Modeler Gold: This edition provides analytical decision management, collaboration and deployment capabilities. SPSS Modeler Gold is moreover available as a cloud offering.
  • IBM SPSS Statistics features

    SPSS Statistics version 24 includes the following original features:

  • The aptitude to access more than 100 extensions, enabling users to bewitch advantage of free libraries written in R, Python and SPSS syntax.
  • The IBM SPSS Extension Hub to browse, download, update, remove and generally manage extensions.
  • A major upgrade to the Custom Dialog Builder, enabling users to more easily build and install their own extensions. Enhancements include original controls and original properties for existing controls and several other improvements to the user interface.
  • Improvements that enable users to more easily and quickly import and export data into SPPS Statistics.
  • Improvements to the Custom Tables module, including original statistical functionality and customer-requested features.
  • IBM SPSS Statistics offers the following three editions (each with additional modules):

  • SPSS Statistics gauge tools provide advanced statistical procedures that uphold linear and nonlinear statistical models, as well as predictive simulation modeling, which accounts for uncertain inputs, geospatial analytics and customized tables.
  • SPSS Statistics Professional tools uphold data preparation, missing values and data validity, decision trees, and forecasting.
  • SPSS Statistics Premium adds advanced analytical techniques, including structural equation modeling, in-depth sampling assessment and testing. This bundle moreover includes procedures that target direct marketing and high-end charts and graphs.
  • Pricing for the SPSS Modeler and SPSS Statistics predictive analytics tools vary depending on the bundle options, the number of users and the license period. SPSS Statistics is now available as a subscription option or a perpetual license. IBM offers free trials of both IBM SPSS Modeler and IBM SPSS Statistics.

    Next Steps

    Why the term unstructured data is a misnomer

    How colossal data is changing data modeling techniques

    Big data systems pose original challenges to data governance

    Related Resources View More

    A absolute Play On Self-Service colossal Data Prep And Analytics: Wait For Smarter Valuation Entry Point | killexams.com actual questions and Pass4sure dumps

    No result found, try original keyword!According to Rexer Analytics, 2016 Data Science Survey of 1220 analytics professionals from 72 countries, the medium analytics professional reports ... s end-to-end data science platform; IBM’s (NYSE ...

    Chronic olanzapine administration causes metabolic syndrome through inflammatory cytokines in rodent models of insulin resistance | killexams.com actual questions and Pass4sure dumps

    Patient Recruitment Process and Sample Collection

    This study recruited schizophrenia patients with long-term administration of olanzapine, whom were diagnosed positive, negative and cognitive impairment or emotional syndrome, according to the PNASS factor scores. Inclusion criteria: (1) age 18–60 years old;(2) no infectious disease, no confirmed cardiovascular, digestive tract, endocrine, immune system and respiratory diseases within two weeks before blood sampling; (3) no family history of diabetes and no major liver or kidney disease; no dismal habits, such as addiction and alcohol abuse; (4) nonpregnancy or lactation; (5) treatment with other humor stabilizers or other atypical antipsychotics (with olanzapine as the primary drug), but no antihypertensive drugs or typical antipsychotics; (6) informed consent; (7) patients treated mainly with olanzapine over 2 months and without hypoglycemic drugs. This clinical study was approved by the Tongji Medical College Ethics Committee of Huazhong University of Science and Technology (HUST).

    We called clinical patients with long-term administration of olanzapine from different hospitals to conduct this study, which included measuring the carcass weight, fasting blood glucose, and insulin levels and calculating the insulin resistance index (HOMA-IR index). In this study, they mainly relied on experienced clinicians to determine the grouping of patients. In clinical practice, they assessed the patient’s metabolic status and insulin sensitivity based on changes in carcass weight and fasting blood glucose after long-term olanzapine treatment. Based on the HOMA-IR index values, the patients were divided into the OS group (the insulin resistance index has similar variations as the medium levels in gardenvariety subjects, data not shown) and the OR group (the insulin resistance index is significantly higher than that of the medium levels in gardenvariety subjects).

    All experiments were performed according to the guidelines and regulations under HUST. The demographic and clinical details of the samples are provided in Table 1.

    After overnight fasting, 10-ml blood samples were obtained from the patients and placed in a test tube that contained EDTAK2 anticoagulant. Following centrifugation at 3000 rpm for 10 min, the plasma was stored at −80 °C for later use.

    Animals, Drug Treatment and Examination of Inflammatory Factors

    Adult female Balb/c mice and Sprague Dawley rats (purchased from Beijing Huafu Kang Biotechnology Co., Ltd., animal license number: SCXK (Beijing) 2014–0004) were group-housed and maintained in the SPF animal scope of the Animal Experiment seat of HUST with a 12-hour light/dark cycle. The animal consume and procedures were in accordance with the HUST Animal Ethics Committee regulations and requirements. utter experiments were performed under HUST animal guidelines and regulations.

    The preempt amount of olanzapine (TCI, Japan) was dissolved with 0.1 M hydrochloric acid solution, with 1 M sodium hydroxide solution to adjust the pH to 6.0. Olanzapine was intraperitoneally injected with dose justification as described and discussed in Wu, et al.50. Briefly, the injection doses were 10 mg/kg, injection volume of 10 ml/kg, with 0.1 M hydrochloric acid as the control. One week after the rodent animals were adaptively fed, they were randomly divided into two groups: the olanzapine treatment group and the control group. The olanzapine and control solvent were orally administered at 8:30 a.m. to 9 a.m. daily for 8 weeks.

    After 8 weeks of administration, the carcass weight, fasting blood glucose and insulin levels were measured, and the Homeostasis model assessment insulin resistance (HOMA-IR) was calculated as shown in Supplemental Table S2. HOMA-IR = fasting blood glucose (mmol/L) * fasting insulin (mU/L) /22.5. The oral glucose tolerance test (OGTT) was performed after the End of the administration, and the area under the blood glucose curve was calculated. Orbital blood samples were obtained in heparin-added EP tubes, plasma was collected, and white adipose tissue was carefully separated. The prefrontal cortex of the rat brains from the OS and OR groups were dissected and immediately stored at −80 °C for later use.

    Blood glucose was measured by a blood glucose detector. Insulin and inflammatory cytokines (TNF-α, IL-6, IL-8 and IL-1β) were measured using ELISA Kits (Neobioscience, China).

    Adipocyte Cell Line and Differentiation Process

    3T3-L1 fibroblasts (Shanghai Meixuan Biotechnology Co., Ltd.) were cultured in DMEM medium (which contained 4 mM L-glutamine, 4.5 g/L glucose and 10% fetal bovine serum) in a 5% CO2 incubator. After 2 days of fusion, the cells were stimulated for elephantine synthesis in DMEM medium that contained 25 mmol/L glucose, 0.5 mmol/L isobutylmethylxanthine, 1 mmol/L dexamethasone, 10 mg/ml insulin and 10% fetal bovine serum. After 3 days, the cells were changed using DMEM medium with 10 mg/ml insulin and 10% FBS. The medium was changed every 2 days during 10–14 day experiment, when 90–95% cells showed adipocyte phenotype.

    Olanzapine Treatment of Adipocytes

    After 3T3-L1 adipocytes (or transfected cells) were incubated with serum-free, tall glucose, DMEM medium and olanzapine at the indicated concentrations were applied for the indicated time, the samples were incubated with 100 nM insulin or blank control solution without insulin for 30 min, and the supernatants were collected. The GOD-POD kit (Nanjing Jiancheng Bioengineering Institute, China) was used to determine the glucose content in the supernatants. The initial glucose content in the medium was subtracted from the glucose content in the supernatant to obtain the glucose content absorbed by the cells. The control cells were incubated with solvent only.

    Examination of Influence on Adipocyte Growth

    After the 3T3-L1 adipocytes were treated with olanzapine under the specified conditions, 10 µL CCK-8 solution was added, and the cells were incubated in an incubator at 37 °C for 2 h. The absorbance at 450 nm was measured using a microplate reader to compute the consequence of olanzapine on cell growth.

    Gene Expression and Knock-down

    IκBα siRNA and P50/p65 siRNA were synthesized by Shanghai Gemma (Ribobio, China). Briefly, prior to transfection, cells were harvested by trypsinization and collected, and the cell density was adjusted to 2 × 105/ml. Corresponding siRNAs were transfected into 3T3-L1 adipocytes using Lipofectamine rTM2000. The positive and vector siRNA were used to assess the transfection and knock-down efficiency. The levels of mRNA and protein expression of the target genes were detected after 48 hours.

    Western Blotting Analyses

    All cell lysates were collected via low-speed centrifugation. Briefly, cells were incubated ice-cooled lysis buffer for 30 minutes, vortexed and extracted the protein via centrifugation; the protein concentration was determined using the BCA method. SDS-PAGE electrophoresis and western blotting procedures were performed. Inflammation activates serine but not threonine phosphorylation of the insulin receptor substrate (IRS-1). Thus, the specific rabbit anti serine p-IRS1 antibody was purchased and applied in the present study, Cat:#2385, CST, USA, 1:500; the other corresponding protein primary antibodies used in this study were as follows: p65, (Cat:#8242, CST, USA, 1:2000); IκBα, (Cat:ab32518, Abcam, England, 1:2000); GLUT4, (Cat:ab33780, Abcam, England, 1:1000); p-AKT, (Cat:#4060, CST, USA, 1:2000); and GAPDH, (Cat:ab37168, Abcam, England, 1:10000). utter primary antibodies were raised from rabbits; thus, a secondary antibody (HRP-Goat anti Rabbit, Cat:AS1107, ASPEN, USA, 1:10000) was used for each western blot analysis. Gel imager detection was performed with an X-ray film reader (Kodak, Japan). A cell membrane GLUT4 assay using a membrane protein extraction kit was used to determine the GLUT4 protein expression.

    Quantitative Real-Time PCR

    Approximately 100 mg of mouse adipose tissue was obtained and extracted by Trizol extraction (15596–026, Invitrogen™). The extracted RNA was added to the invert transcription reaction system for invert transcription. The primers for TNF-α were 5′-TCCCCAAAGGGATGAGAAGTT-3′ and 5′-GAGGAGGTTGACTTTCTCCTGG-3′. The primers for IL-6 were 5′-CTGGGAAATCGTGGAAATGAG-3′ and 5′-AAGGACTCTGGCTTTGTCTTTCT-3′. The primers for IL-1β were 5′-GGGCCTCAAAGGAAAGAATCT-3′ and 5′-GAGGTGCTGATGTACCAGTTGG-3′. The primers for IL-8 were 5′-GGCCCAATTACTAACAGGTTCC-3′ and 5′-TGACTTCACTGGAGTCCCGTAG-3′. The primers for GAPDH were 5′-TGAAGGGTGGAGCCAAAAG-3′ and 5′-AGTCTTCTGGGTGGCAGTGAT-3′. Real-time PCR was performed on a StepOne™ Real-Time PCR instrument using the SYBR® Premix Ex Taq™ kit (RR047A, TaKaRa, Japan). The calculation formula was as follows: ΔCt = Ct value of the target gene - Ct value of the reference gene; ΔΔCt = ΔCt of control group - ΔCt of the experimental group; the relative expression value of the target gene in the sample of the experimental group is 2ΔΔCt.

    Electrophoretic Mobility Shift Assay

    Following the cell intervention experiment, the nucleoprotein was extracted, and the protein concentration was determined with the purchased kit. Gel was prepared. After the gel was completely solidified, it was electrophoresed for 1 h at 100 v. After the pre-electrophoresis was completed, the precooled electrophoresis buffer was replaced, and 5 µl of 5x sample buffer was added to the sample mixture. Electrophoresis was then immediately performed at 150 v for 30–45 minutes. The positively charged nylon membrane was placed in a 0.5 x TBE for 10 minutes. After the electrophoresis was completed, the entire block of the sample was removed and transferred. After the membrane was completed, the membrane was marked and cross-linked under UV for 10 min. The membrane was blocked with blocking solution for 15 minutes. After being diluted 300-fold with blocking solution, the antibody was fully reacted with the membrane for 15 minutes. The membrane was subsequently washed and balanced. The image to the protein side of the membrane was taken. The film was scanned and analyzed with the AlphaEaseFC system. The oligos were AGTTGAGGGGACTTTCCCAGGC(5′−3′) and TCAACTCCCCTGAAAGGGTCCG(5′−3′).

    Statistical Analyses

    The PANSS scaling was used to measure the symptom severity of the patients with schizophrenia. The minimum scores for the positive, negative and common scales are 7, 7, and 16 and are used for the matched controls. Student’s t test was used to compare two groups for continuous variables. A Chi-square test was used to compare two groups for binary variables.

    SPSS19.0 (SPSS Inc., IBM, USA) was used to process utter animal and cell experimental data as mean ± SD. Analysis of variance (ANOVA) was used to compare multiple groups, and the least significant dissimilarity (LSD) was used for comparisons among groups. A logistic regression model was used for variables of each inflammatory factor with covariates of the HOMA-IR index. Pearson correlation scores were calculated for every inflammatory factor and the normalized HOMA-IR index values.

    Statistical significance was set at p < 0.05. utter experiments were repeated at least 3 times.

    Ethical approval and informed consent

    The consume of utter human samples and blood tissues in this study complied with the guidelines and regulations of the Tongji Medical College Ethics Committee of Huazhong University of Science and Technology (HUST). utter experiments on human samples were approved by the Tongji Medical College Ethics Committee of HUST.

    All experiments on rodents were approved by the HUST Animal Ethics Committee and were performed under the HUST animal guidelines and regulations.



    Direct Download of over 5500 Certification Exams

    3COM [8 Certification Exam(s) ]
    AccessData [1 Certification Exam(s) ]
    ACFE [1 Certification Exam(s) ]
    ACI [3 Certification Exam(s) ]
    Acme-Packet [1 Certification Exam(s) ]
    ACSM [4 Certification Exam(s) ]
    ACT [1 Certification Exam(s) ]
    Admission-Tests [13 Certification Exam(s) ]
    ADOBE [93 Certification Exam(s) ]
    AFP [1 Certification Exam(s) ]
    AICPA [2 Certification Exam(s) ]
    AIIM [1 Certification Exam(s) ]
    Alcatel-Lucent [13 Certification Exam(s) ]
    Alfresco [1 Certification Exam(s) ]
    Altiris [3 Certification Exam(s) ]
    Amazon [2 Certification Exam(s) ]
    American-College [2 Certification Exam(s) ]
    Android [4 Certification Exam(s) ]
    APA [1 Certification Exam(s) ]
    APC [2 Certification Exam(s) ]
    APICS [2 Certification Exam(s) ]
    Apple [69 Certification Exam(s) ]
    AppSense [1 Certification Exam(s) ]
    APTUSC [1 Certification Exam(s) ]
    Arizona-Education [1 Certification Exam(s) ]
    ARM [1 Certification Exam(s) ]
    Aruba [6 Certification Exam(s) ]
    ASIS [2 Certification Exam(s) ]
    ASQ [3 Certification Exam(s) ]
    ASTQB [8 Certification Exam(s) ]
    Autodesk [2 Certification Exam(s) ]
    Avaya [96 Certification Exam(s) ]
    AXELOS [1 Certification Exam(s) ]
    Axis [1 Certification Exam(s) ]
    Banking [1 Certification Exam(s) ]
    BEA [5 Certification Exam(s) ]
    BICSI [2 Certification Exam(s) ]
    BlackBerry [17 Certification Exam(s) ]
    BlueCoat [2 Certification Exam(s) ]
    Brocade [4 Certification Exam(s) ]
    Business-Objects [11 Certification Exam(s) ]
    Business-Tests [4 Certification Exam(s) ]
    CA-Technologies [21 Certification Exam(s) ]
    Certification-Board [10 Certification Exam(s) ]
    Certiport [3 Certification Exam(s) ]
    CheckPoint [41 Certification Exam(s) ]
    CIDQ [1 Certification Exam(s) ]
    CIPS [4 Certification Exam(s) ]
    Cisco [318 Certification Exam(s) ]
    Citrix [48 Certification Exam(s) ]
    CIW [18 Certification Exam(s) ]
    Cloudera [10 Certification Exam(s) ]
    Cognos [19 Certification Exam(s) ]
    College-Board [2 Certification Exam(s) ]
    CompTIA [76 Certification Exam(s) ]
    ComputerAssociates [6 Certification Exam(s) ]
    Consultant [2 Certification Exam(s) ]
    Counselor [4 Certification Exam(s) ]
    CPP-Institue [2 Certification Exam(s) ]
    CPP-Institute [1 Certification Exam(s) ]
    CSP [1 Certification Exam(s) ]
    CWNA [1 Certification Exam(s) ]
    CWNP [13 Certification Exam(s) ]
    Dassault [2 Certification Exam(s) ]
    DELL [9 Certification Exam(s) ]
    DMI [1 Certification Exam(s) ]
    DRI [1 Certification Exam(s) ]
    ECCouncil [21 Certification Exam(s) ]
    ECDL [1 Certification Exam(s) ]
    EMC [129 Certification Exam(s) ]
    Enterasys [13 Certification Exam(s) ]
    Ericsson [5 Certification Exam(s) ]
    ESPA [1 Certification Exam(s) ]
    Esri [2 Certification Exam(s) ]
    ExamExpress [15 Certification Exam(s) ]
    Exin [40 Certification Exam(s) ]
    ExtremeNetworks [3 Certification Exam(s) ]
    F5-Networks [20 Certification Exam(s) ]
    FCTC [2 Certification Exam(s) ]
    Filemaker [9 Certification Exam(s) ]
    Financial [36 Certification Exam(s) ]
    Food [4 Certification Exam(s) ]
    Fortinet [13 Certification Exam(s) ]
    Foundry [6 Certification Exam(s) ]
    FSMTB [1 Certification Exam(s) ]
    Fujitsu [2 Certification Exam(s) ]
    GAQM [9 Certification Exam(s) ]
    Genesys [4 Certification Exam(s) ]
    GIAC [15 Certification Exam(s) ]
    Google [4 Certification Exam(s) ]
    GuidanceSoftware [2 Certification Exam(s) ]
    H3C [1 Certification Exam(s) ]
    HDI [9 Certification Exam(s) ]
    Healthcare [3 Certification Exam(s) ]
    HIPAA [2 Certification Exam(s) ]
    Hitachi [30 Certification Exam(s) ]
    Hortonworks [4 Certification Exam(s) ]
    Hospitality [2 Certification Exam(s) ]
    HP [750 Certification Exam(s) ]
    HR [4 Certification Exam(s) ]
    HRCI [1 Certification Exam(s) ]
    Huawei [21 Certification Exam(s) ]
    Hyperion [10 Certification Exam(s) ]
    IAAP [1 Certification Exam(s) ]
    IAHCSMM [1 Certification Exam(s) ]
    IBM [1532 Certification Exam(s) ]
    IBQH [1 Certification Exam(s) ]
    ICAI [1 Certification Exam(s) ]
    ICDL [6 Certification Exam(s) ]
    IEEE [1 Certification Exam(s) ]
    IELTS [1 Certification Exam(s) ]
    IFPUG [1 Certification Exam(s) ]
    IIA [3 Certification Exam(s) ]
    IIBA [2 Certification Exam(s) ]
    IISFA [1 Certification Exam(s) ]
    Intel [2 Certification Exam(s) ]
    IQN [1 Certification Exam(s) ]
    IRS [1 Certification Exam(s) ]
    ISA [1 Certification Exam(s) ]
    ISACA [4 Certification Exam(s) ]
    ISC2 [6 Certification Exam(s) ]
    ISEB [24 Certification Exam(s) ]
    Isilon [4 Certification Exam(s) ]
    ISM [6 Certification Exam(s) ]
    iSQI [7 Certification Exam(s) ]
    ITEC [1 Certification Exam(s) ]
    Juniper [64 Certification Exam(s) ]
    LEED [1 Certification Exam(s) ]
    Legato [5 Certification Exam(s) ]
    Liferay [1 Certification Exam(s) ]
    Logical-Operations [1 Certification Exam(s) ]
    Lotus [66 Certification Exam(s) ]
    LPI [24 Certification Exam(s) ]
    LSI [3 Certification Exam(s) ]
    Magento [3 Certification Exam(s) ]
    Maintenance [2 Certification Exam(s) ]
    McAfee [8 Certification Exam(s) ]
    McData [3 Certification Exam(s) ]
    Medical [69 Certification Exam(s) ]
    Microsoft [374 Certification Exam(s) ]
    Mile2 [3 Certification Exam(s) ]
    Military [1 Certification Exam(s) ]
    Misc [1 Certification Exam(s) ]
    Motorola [7 Certification Exam(s) ]
    mySQL [4 Certification Exam(s) ]
    NBSTSA [1 Certification Exam(s) ]
    NCEES [2 Certification Exam(s) ]
    NCIDQ [1 Certification Exam(s) ]
    NCLEX [2 Certification Exam(s) ]
    Network-General [12 Certification Exam(s) ]
    NetworkAppliance [39 Certification Exam(s) ]
    NI [1 Certification Exam(s) ]
    NIELIT [1 Certification Exam(s) ]
    Nokia [6 Certification Exam(s) ]
    Nortel [130 Certification Exam(s) ]
    Novell [37 Certification Exam(s) ]
    OMG [10 Certification Exam(s) ]
    Oracle [279 Certification Exam(s) ]
    P&C [2 Certification Exam(s) ]
    Palo-Alto [4 Certification Exam(s) ]
    PARCC [1 Certification Exam(s) ]
    PayPal [1 Certification Exam(s) ]
    Pegasystems [12 Certification Exam(s) ]
    PEOPLECERT [4 Certification Exam(s) ]
    PMI [15 Certification Exam(s) ]
    Polycom [2 Certification Exam(s) ]
    PostgreSQL-CE [1 Certification Exam(s) ]
    Prince2 [6 Certification Exam(s) ]
    PRMIA [1 Certification Exam(s) ]
    PsychCorp [1 Certification Exam(s) ]
    PTCB [2 Certification Exam(s) ]
    QAI [1 Certification Exam(s) ]
    QlikView [1 Certification Exam(s) ]
    Quality-Assurance [7 Certification Exam(s) ]
    RACC [1 Certification Exam(s) ]
    Real-Estate [1 Certification Exam(s) ]
    RedHat [8 Certification Exam(s) ]
    RES [5 Certification Exam(s) ]
    Riverbed [8 Certification Exam(s) ]
    RSA [15 Certification Exam(s) ]
    Sair [8 Certification Exam(s) ]
    Salesforce [5 Certification Exam(s) ]
    SANS [1 Certification Exam(s) ]
    SAP [98 Certification Exam(s) ]
    SASInstitute [15 Certification Exam(s) ]
    SAT [1 Certification Exam(s) ]
    SCO [10 Certification Exam(s) ]
    SCP [6 Certification Exam(s) ]
    SDI [3 Certification Exam(s) ]
    See-Beyond [1 Certification Exam(s) ]
    Siemens [1 Certification Exam(s) ]
    Snia [7 Certification Exam(s) ]
    SOA [15 Certification Exam(s) ]
    Social-Work-Board [4 Certification Exam(s) ]
    SpringSource [1 Certification Exam(s) ]
    SUN [63 Certification Exam(s) ]
    SUSE [1 Certification Exam(s) ]
    Sybase [17 Certification Exam(s) ]
    Symantec [134 Certification Exam(s) ]
    Teacher-Certification [4 Certification Exam(s) ]
    The-Open-Group [8 Certification Exam(s) ]
    TIA [3 Certification Exam(s) ]
    Tibco [18 Certification Exam(s) ]
    Trainers [3 Certification Exam(s) ]
    Trend [1 Certification Exam(s) ]
    TruSecure [1 Certification Exam(s) ]
    USMLE [1 Certification Exam(s) ]
    VCE [6 Certification Exam(s) ]
    Veeam [2 Certification Exam(s) ]
    Veritas [33 Certification Exam(s) ]
    Vmware [58 Certification Exam(s) ]
    Wonderlic [2 Certification Exam(s) ]
    Worldatwork [2 Certification Exam(s) ]
    XML-Master [3 Certification Exam(s) ]
    Zend [6 Certification Exam(s) ]





    References :


    Dropmark : http://killexams.dropmark.com/367904/11704552
    Wordpress : http://wp.me/p7SJ6L-17S
    Issu : https://issuu.com/trutrainers/docs/bas-010
    Dropmark-Text : http://killexams.dropmark.com/367904/12197621
    Blogspot : http://killexamsbraindump.blogspot.com/2017/11/get-high-marks-in-bas-010-exam-with.html
    RSS Feed : http://feeds.feedburner.com/Pass4sureBas-010DumpsAndPracticeTestsWithRealQuestions
    Box.net : https://app.box.com/s/abw5dk8v81g0tf8q2foneya8lhfhi1nb
    publitas.com : https://view.publitas.com/trutrainers-inc/dont-miss-these-ibm-bas-010-dumps
    zoho.com : https://docs.zoho.com/file/5s0qsc0f19a2d20884f2796c7cc9fd5574232











    Killexams exams | Killexams certification | Pass4Sure questions and answers | Pass4sure | pass-guaratee | best test preparation | best training guides | examcollection | killexams | killexams review | killexams legit | kill example | kill example journalism | kill exams reviews | kill exam ripoff report | review | review quizlet | review login | review archives | review sheet | legitimate | legit | legitimacy | legitimation | legit check | legitimate program | legitimize | legitimate business | legitimate definition | legit site | legit online banking | legit website | legitimacy definition | pass 4 sure | pass for sure | p4s | pass4sure certification | pass4sure exam | IT certification | IT Exam | certification material provider | pass4sure login | pass4sure exams | pass4sure reviews | pass4sure aws | pass4sure security | pass4sure cisco | pass4sure coupon | pass4sure dumps | pass4sure cissp | pass4sure braindumps | pass4sure test | pass4sure torrent | pass4sure download | pass4surekey | pass4sure cap | pass4sure free | examsoft | examsoft login | exams | exams free | examsolutions | exams4pilots | examsoft download | exams questions | examslocal | exams practice |



     

    Gli Eventi